Drosophila stocks and genetics
The following Drosophila stocks were used in this study: HmlΔ-Gal4 (S. Sinenko), HmlΔ-Gal4 UAS-2xeGFP (S. Sinenko), lz-LexA LexAop-mCherry (J. Shim), UAS-hid,rpr (J. R. Nambu), 21-7-Gal4 (Y. N. Jan), btl-Gal4 UAS-GFP (BL8807), btl-Gal4 (BL78328), HmlΔ-dsRed (K. Brueckner), UAS-NotchICD (U. Banerjee), 20xUAS-shits/TM6B (A. J. Kim), UAS-Gtpx (W.-J. Lee), tub-cyto-roGFP2-Orp1 (BL67670), UAS-PPO2-V5 (W.-J. Lee), tub-Gal80ts (BL7016), btl RNAi (BL43544), lzr15 (BL33835), lz-Gal4 UAS-GFP (BL6314), 20xUAS-6xmCherry-HA (BL52268), 13xLexAop-6xmCherry-HA (BL52271), PPO2Δ (BL56205), PPO1Δ (BL56204), OK72-Gal4 (DGRC108801), UAS-mCD8::GFP (BL5137), eater1 (BL68388), hs-Gal4 UAS-nlsTimer (BL78057), Notch-Gal4 (BL49528), PPO2 RNAi (VDRC107772), CAH2 RNAi (VDRC108184), MtnA RNAi (VDRC105011), Atox1 RNAi (VDRC104437), Ctr1A RNAi (BL58107), Punt RNAi (VDRC37279), Baboon RNAi (VDRC3825), dSmad2 RNAi (VDRC14609), polo RNAi (BL36093, BL33042, BL35146, BL36702), stg RNAi (BL34831, BL29556, BL36094), ush RNAi (BL32950, BL44041, BL29516), Ras85D RNAi (BL34619), PPO1 RNAi (VDRC 107599), fok RNAi (BL63980), CG10467 RNAi (BL62208), Men RNAi (BL38256), CG15343 RNAi (VDRC101184), Pde1c RNAi (VDRC101906), CG9119 RNAi (VDRC46326), CG7860 RNAi (VDRC108281), CG10469 RNAi (BL55291), mthl10 RNAi (BL51753), Gip RNAi (VDRC105750), CG17109 RNAi (BL54033), Naxd RNAi (VDRC39667), peb RNAi (BL28735), tna RNAi (BL29372), Duox RNAi (U. Banerjee) and UAS-Sod2 (BL24494). w1118 (BL3605) and Oregon R (BL5) were used as wild types. HmlLT-Gal4 is a lineage tracing of Hml+ haemocytes containing HmlΔ-Gal4;UAS-FLP;ubi-FRT-STOP-FRT-Gal4.
The following recombinants or combinations were generated in this study: HmlΔ-Gal4 UAS-eGFP;lz-LexA LexAop-mCherry, btl-Gal4 UAS-GFP;lz-LexA LexAop-mCherry, UAS-mCD8::GFP;21-7-Gal4;HmlΔ-LexA LexAop-mCherry, UAS-mCD8::GFP;21-7-Gal4, lz-LexA LexAop-mCherry, lzr15;HmlΔ-Gal4 UAS-eGFP, ok72-Gal4 UAS-mCD8::GFP; lz-LexA LexAop-mCherry, HmlΔ-dsRed;btl-Gal4 UAS-GFP, btl-Gal4 UAS-GFP;lz-LexA LexAop-mCherry, 21-7-Gal4 UAS-mCD8::GFP;lz-LexA LexAop-mCherry, tub-Gal80ts;btl-Gal4 UAS-GFP, PPO2Δ;hs-Gal4 UAS-Timer, PPO2Δ;Notch-Gal4, PPO2Δ;UAS-PPO2, PPO2Δ;UAS-PPO2H369N, PPO2Δ;UAS-Timer and PPO2Δ;UAS-L. pol Hc2-Flag.
The following stocks were generated in this study: HmlΔ-LexA, lz-Gal4, UAS-PPO2, UAS-PPO2-eGFP, UAS-PPO2-Flag, UAS-PPO2H369N, UAS-PPO2H212NH/369N, UAS-PPO2R50A, UAS-PPO2H212NH/369N-Flag and UAS-L.pol Hc2-Flag. For HmlΔ-LexA, the Hml enhancer was amplified from genomic DNA and cloned into a TOPO-TA vector (K252020; Thermo Fisher Scientific) for gateway cloning. The cloned entry vector was ligated into the pBPnlsLexA::p65Uw (26230; Addgene) destination vector using LR ligase (11791-020; Thermo Fisher Scientific). lz-Gal4 was generated by splitting and rebalancing lz-Gal4 UAS-eGFP, 20xUAS-6xmCherry-HA with Basc/FM7i;MKRS/TM6B. For UAS-PPO2, PPO2 cDNA was amplified from RNA extracted from larval haemocytes and cloned into the pGEM-T Easy vector (A1360; Promega). PPO2 cDNA with restriction enzyme sites was amplified for ligation into the pUASTattB vector (1419; DGRC). For UAS-PPO2-eGFP, PPO2 or eGFP, respectively, cDNA was amplified for ligation using a Gibson Assembly kit (E2611L; New England Biolabs). A linker (5′-GGCGGCGGCGGC-3′) was inserted between PPO2 and eGFP. PPO2-linker-eGFP with a restriction enzyme site was amplified and ligated into the pUAST-attB vector (1419; DGRC). Mutagenesis of UAS-PPO2 to produce UAS-PPO2H369N, UAS-PPO2R50A and UAS-PPO2H369N/H212N was performed using a mutagenesis kit (EZ004S; Enzynomics). PCR for UAS-PPO2WT-Flag or PPO2H369N/H212N-Flag was performed based on UAS-PPO2 or UAS-PPO2H369N/H212N, respectively, using Flag primers. For UAS-L.pol haemocyanin 2-Flag, L. polyphemus haemocyanin 2 gene fragments were synthesized by IDT; it was then amplified by PCR and cloned into the pGEM-T Easy vector (A1360; Promega). L. polyphemus Hc2 cDNA was amplified with Flag primers for ligation into the pUASTattB vector (1419; DGRC). Detailed genotypes, sample sizes and Gal4 drivers with corresponding target tissues are listed in Supplementary Table 5. Experiments were independently repeated at least three times. A list of the primers used for cloning is provided in Supplementary Table 6.
Transgenic flies were generated by BestGene or KDRC. Unless indicated, all fly crosses and larvae were maintained at 25 °C and in normal dextrose–cornmeal-based food.
tub-GAL80ts;btl-GAL4 UAS-GFP crossed with UAS-btl RNAi flies or 21-7-GAL4 UAS-mCD8::GFP crossed with UAS-shits flies were maintained at 18 °C for 5 days (until the early second instar) and then transferred to 29 °C to avoid the larval lethal phenotype. Flies or larvae were randomly selected to perform all the experiments. Blinding was not applicable due to the complex genetic background and environmental conditions used in this study. All the data were collected based on unbiased analyses. Males and females of the same age, respectively, were used for experiments using flies. Unless indicated, the third-instar larvae at 120 hours after egg laying were used for experiments using larvae.
O2 control experiments
All of the experiments were conducted in an O2/CO2 control chamber (ProOx Model C21; BioSpherix). For anoxia, hypoxia and hyperoxia experiments, 0.1%, 5% and 60% O2 were used, respectively. All larvae were synchronized and raised in the chamber for the indicated periods. Larvae were bled and imaged at 120 h AEL at 25 °C. For example, for 4 h hypoxia, larvae were synchronized and raised in normoxia until 116 h AEL and then transferred to 5% O2 at 116 h AEL until 120 h AEL. After 4 h in hypoxia, larvae were bled at 120 h AEL.
Cell transfection
Drosophila S2R+ cells were maintained at 25 °C in Schneider’s medium (21720-024; Thermo Fisher Scientific) with 10% FBS, 50 U penicillin and 50 µg streptomycin per ml. To express Flag-tagged proteins, Drosophila S2R+ cells were transfected using the Cellfection reagent (58760; Thermo Fisher Scientific). UAS vector (pUASt-PPO2-Flag, pUASt-PPO2H212N/H369N-Flag, and UAS L. polyphemus haemocyanin 2-Flag) were co-transfected with pAC5C-Gal4. After transfection, S2R+ cells were incubated for 72 h before cell collection. The S2R+ cell line was confirmed by the morphology and was only used for protein purification.
Immunoprecipitation and absorbance spectrum measurement
Immunoprecipitation was performed to isolate the Flag-tagged proteins from transfected Drosophila S2R+ cells. Cells were lysed in IP buffer (50 mM Tris-HCl, 50 mM NaCl, 300 mM sucrose, 1% Triton X-100, 0.2 mM PMSF) containing protease inhibitor cocktail (P9599; Sigma-Aldrich) on ice for 5 min after vortexing. Cell lysates were cleared by centrifugation at 12,000g and 4 °C for 15 min to remove cellular debris. Supernatants were collected and incubated with Anti-DYKDDDDK G1 Affinity Resin (L00432-1; GenScript Biotech) for 1 h at 4 °C with gentle rotation. The beads were washed three times with wash buffer (50 mM Tris-HCl, 50 mM NaCl, 300 mM sucrose, 0.2% Triton X-100, 0.2 mM PMSF, including protease inhibitor cocktail) to remove non-specific binding and the Flag-tagged proteins were eluted using 3× Flag peptide (F4799; Sigma-Aldrich) elution solution (150 ng µl−1 of 3× Flag peptide in 100 mM pH 7.5 Tris, 150 mM NaCl, 10 µM CuSO4) for 30 min at 4 °C. The 3× Flag peptide stock solution was made by dissolving 3× Flag peptide in 0.5 M Tris HCl, pH 7.5 and 1 M NaCl at a final concentration of 25 µM µl−1. Eluted proteins were then subjected to spectrophotometry analysis. Absorption spectra were measured using a spectrophotometer (Cary 60 UV-Vis; Agilent Technologies) at wavelengths of 200–800 nm at 0.5 nm intervals.
Haemocyte bleeding
To bleed out the entire haemocyte population, including circulating and sessile cells, larvae were vortexed as described previously59 and bled on a glass slide (61.100.17; Immuno-Cell). Circulating haemocytes were obtained without any disturbance. After bleeding the larvae, haemocytes were allowed to settle for 40 min at 4 °C. Sessile haemocytes were collected by vigorously pipetting larval carcasses with PBS as described previously1. Haemocytes were fixed with a 3.7% formaldehyde solution, washed three times with 0.4% PBS-T (Triton X-100) for 10 min and blocked in 10% normal goat serum solution for 30 min. Primary antibody was added, and the slides containing haemocytes were incubated at 4 °C overnight. Haemocytes were washed three times with 0.4% PBS-T (Triton X-100) for 10 min and secondary antibody was added. The slides were incubated at room temperature for 3 h. Haemocytes were again washed three times with 0.4% PBS-T (Triton X-100) for 10 min each with a final wash with PBS for 3 min. Haemocyte samples were mounted in Vectashield (Vector Laboratories) with DAPI and imaged using a Nikon C2 Si-plus confocal microscope (Nikon).
Live imaging of haemocytes
To visualize crystal assembly and dissolution ex vivo, we vortexed larvae for 2 min with glass bleeds (Sigma-Aldrich, G9268) as described above59. Larvae expressing PPO1-Gal4 UAS-PPO2-eGFP were bled in 20 µl of Schneider’s medium (21720-024; Thermo Fisher Scientific) onto a glass-bottomed confocal dish (100350; SPL Life Sciences) and allowed to settle for 10 min. Haemocytes were washed with 20 µl Schneider’s medium and imaged using the Zeiss LSM 900 confocal microscope (Zeiss) with an incubation system at 25 °C at the Biospecimen-Multiomics Digital Bioanalysis Core Facility of Hanyang University. Humidity was maintained by the incubator.
Haemocyte reattachment assay
To measure the number of haemocytes that returned to the haematopoietic pocket over 30 min, synchronized larvae grown until 116 h AEL were collected and cultured in a hypoxic chamber for 3.5 h. Larvae were collected in a tube, vortexed for 2 min with glass beads (Sigma-Aldrich, G9268) as described previously59 and placed back into the hypoxic chamber for another 30 min. After the 30 min incubation, larvae were bled onto a slide (61.100.17; Immuno-Cell International), and sessile or circulating haemocytes were counted.
Live imaging of whole larvae
At 120 h AEL, synchronized larvae (HmlΔ-Gal4 UAS-EGFP; lz-LexA LexAop-mCherry) were placed in a larva-holding cassette (custom made by 3D printing). To prevent larvae from moving, larvae were covered by a cover glass (Deckglaser, 22 × 50 mm) and sealed on both sides with tape. Live imaging was recorded for 1 h using a Nikon A1 confocal microscope (Nikon) with an installed 5% O2 hypoxia chamber.
Immunohistochemistry
The following primary antibodies were used in this study: anti-Pxn (1:1,000, rabbit)60, anti-Hnt (1:10, mouse; DSHB), anti-lz (1:10, mouse; DSHB), anti-PPO2 (1:1,000, rabbit), anti-Sima (1:1,000, guinea pig)61, anti-PH3 (1:500, rabbit; 06-570, Merck Millipore), anti-Flag (1:1,000, mouse; Sigma-Aldrich, F1804) and anti-DCP1 (1:100, rabbit; 9578, Cell Signaling).
Cy3-conjugated, 647-conjugated and FITC-conjugated secondary antibodies (Jackson Laboratory) were used at dilutions of 1:250.
To generate antisera specific to the PPO2 protein, a 6×His-tag fusion protein containing the entire PPO2 protein was produced using Escherichia coli (pET21a-PPO2). The recombinant PPO2-6×His proteins were purified and injected into rabbits to generate polyclonal antibodies (GenScript).
TEM analysis
Ten third instar larvae were bled, collected and washed in PBS and fixed in 3% glutaraldehyde in 0.1 M cacodylate buffer (pH 7.2) containing 0.1% CaCl2 for 3 h at room temperature. This process was repeated until the desired amount. Haemocytes were washed five times with 0.1 M cacodylate buffer at 4 °C and were post-fixed with 1% OsO4 in 0.1 M cacodylate buffer containing 0.1% CaCl2 for 2 h at 4 °C. These samples were embedded in Embed-812 (EMS). After polymerization of the resin at 60 °C for 36 h, serial sections were cut with a diamond knife on a ULTRACUT UC7 ultramicrotome (Leica) and mounted onto formvar-coated slot grids. The sections were stained with 4% uranyl acetate for 10 min and lead citrate for 7 min. TEM imaging was conducted on a Tecnai G2 Spirit Twin transmission electron microscope (Thermo Fisher Scientific).
RT–qPCR
More than 50 wandering third instar larvae were bled for haemocyte RNA extraction, and cDNA was synthesized using a quantitative PCR with reverse transcription (RT–qPCR) kit (TOYOBO). RT–qPCR was performed using the SYBR Green Master Mix and the comparative Ct method using the Step One-Plus Real-Time PCR thermal cycler (Thermo Fisher Scientific). Gene expression was normalized to Rp49 expression, and a list of the specific primers used for RT–qPCR is provided in Supplementary Table 6.
Imaging of whole circulating or sessile haemocytes
Larvae were placed on a glass slide with 100% glycerol and heated for 30 s on a 70 °C heat block27. Larvae were gently overlain with a cover glass without sealing. Whole circulating or sessile haemocytes were scanned using the Nikon C2 Si-plus confocal microscope (Nikon) or the Zeiss Axiocam 503 (Zeiss) system. In all of the images shown, the anterior is left, and the dorsal side is up.
pHrodo green AM intracellular pH indicator
All of the steps were performed as described in the previous study, except for a few modifications62. Two larvae were bled in pHrodo green dye (P35373, Thermo Fisher Scientific) for 25 min at room temperature. Haemocytes were washed once with PBS for 4 min. Haemocyte samples were mounted in Vectashield (Vector Laboratories) and imaged immediately after mounting with a Nikon C2 Si-plus confocal microscope (Nikon). To create a standard curve using pHrodo green, two larvae were bled in pHrodo green dye and incubated for 25 min at room temperature. Haemocytes were washed once with Life Cell Imaging Solution (LCIS, A14291DJ, Thermo Fisher Scientific) for 3 min and then with buffer solutions of different pHs (pH 7.5, 6.5, 5.5 and 4.5) for 5 min each. Haemocyte samples were mounted in Vectashield (Vector Laboratories) with DAPI and imaged using a Nikon C2 Si-plus confocal microscope (Nikon). A linear function graph was constructed by obtaining GFP intensity values in each pH buffer. pH values were calculated from GFP intensities based on the graph. For image acquisition, three larvae were bled into one well, and the intensity was averaged by randomly selecting four sections. One dot indicates one trial, and each trial involves quantification of three larvae in one well.
Tracheal TTBs
The procedure for TTB quantification was performed according to a previously described protocol7 with a few modifications. Wandering third instar larvae were mounted using the same procedure as for whole-larval imaging. TTBs of immobilized larvae were visualized under a bright-field microscope (Zeiss Axiocam 503, Zeiss). Dorsal views of segment T3 were magnified for TTB images, and TTBs on both sides were counted. Sample sizes (n) indicate the number of larvae counted. In all images, z stacks were analysed using ImageJ, and the anterior is up. Synchronized larvae were grown under normoxic conditions (21% O2) or shifted to either hypoxia (5% O2) or hyperoxia (60% O2) at 96 h AEL (hypoxia) or 60 h AEL (hyperoxia) until 120 h AEL. Excel v.16.58 (Microsoft) and Prism 9 (GraphPad) were used to calculate P values and to produce the final graphs.
nlsTimer in Drosophila organs and haemocytes
For measuring nlsTimer in organs, all of the steps were performed as described in the previous study, except for a few modifications47. Synchronized first-instar larvae at 24 h AEL were collected and raised at 25 °C until 60 h AEL. Larvae were heat-shocked at 37 °C for 20 min followed by recovery at 18 °C for 6 h. After recovery, larvae were raised at 25 °C until 120 h AEL. For hypoxic conditions, larvae were raised in the 5% O2 chamber immediately after the 18 °C recoveries. At 120 h AEL, the brain, trachea, muscle, foregut, midgut, hindgut, salivary gland, fat body, eye disc and leg disc were collected in ice-cooled PBS. After 30 min of fixation with a 3.7% formaldehyde solution at 25 °C, the samples were washed one time each briefly in 0.4% PBS-T and then 1× PBS. After the final wash, the samples were maintained in Vectashield (Vector Laboratories) without DAPI.
For measuring nlsTimer in haemocytes, synchronized first-instar larvae at 24 h AEL were collected and raised at 25 °C until 120 h AEL. For hypoxic conditions, larvae were switched to the 5% O2 chamber and raised there from 60 h AEL to 120-h AEL. Larvae were bled at 120 h AEL. All of the samples were scanned with the Nikon C2 Si-plus confocal microscope (Nikon). Scan settings were described previously47.
Larval survival rate
Forty synchronized larvae were transferred to individual vials and grown under 21% O2. After rearing until 120 h AEL, live larvae (>2.8 mm in length for third-instar larvae)26 were counted per vial. For survival rates in hypoxia or hyperoxia, synchronized larvae were transferred to individual vials at 24 h AEL and shifted to 5% O2 or 60% O2 until 120 h AEL. For survival rates in shallow food, synchronized larvae were cultured in normoxia and transferred to 3-mm-deep food at 24 h AEL. One dot represents one trial (n = 40). Excel v.16.58 (Microsoft) and Prism 9 (GraphPad) were used to calculate P values and produce the final graphs.
Pupal volume
Synchronized larvae were cultured in normoxia and transferred to hypoxia or hyperoxia at 114 h AEL, and phenotypes were observed after pupariation at 144 h AEL. Pupal volume was measured using ImageJ (NIH) and calculated using the formula 4/3π(L/2)(l/2)2, where L is the length and l is the diameter63. Excel v.16.58 (Microsoft) and Prism 9 (GraphPad) were used to calculate P values and produce the final graphs.
Quantification of samples, statistics and reproducibility
All haemocyte samples were visualized using the Zeiss Axiocam 503 (Zeiss) (2.5×) system with DAPI, GFP and RFP. ImageJ (NIH) was used to quantify circulating, sessile or total haemocytes. Imaris (Bitplane) was used to analyse crystal cell numbers in the lymph gland. For proximity measurements, Imaris (Bitplane) was used to calculate the proximity index. Each haemocyte (crystal cell, plasmatocyte) was made into a circle spot (threshold = 8 μm), and oenocytes, tracheal branching or neurons were made into 3D surfaces. Spots close to the surface were calculated (threshold = 5 μm) and normalized with their length.
For analysing haemocyte nlsTimer expression, all haemocyte samples were visualized using the Nikon C2 Si-plus confocal microscope (Nikon) (40×) with GFP and RFP. Two to four images were taken in each well (trial). Each haemocyte intensity was measured using ImageJ (NIH), and the M/G ratio was calculated. Other organs expressing nlsTimer were visualized using the Nikon C2 Si-plus confocal microscope (Nikon) (20×) with GFP and RFP. Twenty to thirty nuclei were measured per organ using ImageJ (NIH), and the M/G ratio was calculated. For analysing the ratio of crystalline to cytosolic structures among all PPO2+ crystal cells, one larva was placed on the bleeding slide at a time, and all PPO2+ cells were observed at 600× magnification through the Nikon C2 Si-plus confocal microscope (Nikon).
The detailed sample sizes for all experiments are indicated in Supplementary Table 5. At least three biologically independent samples were examined to perform statistical analyses. The centre values in all of the box and whisker plots in Figs. 1, 2, 4 and 5 and Extended Data Figs. 1–4 and 6–8 indicate the median values. The experiments shown in Fig. 3b were repeated four times, those in Figs. 3h and 4b were repeated three times and those in Extended Data Figs. 1f,h and 3i were repeated twice.
BioTracker green copper live-cell dye
All of the steps were performed as described in a previous study64, except for a few modifications. Larvae were bled in BioTracker Green Copper dye (SCT041; Sigma-Aldrich) for 40 min at room temperature. Haemocytes were washed once with PBS for 4 min. Haemocyte samples were mounted in Vectashield (Vector Laboratories) and imaged immediately after mounting with the Nikon C2 Si-plus confocal microscope (Nikon).
Shallow food preparation
A cornmeal, dextrose and yeast food recipe (Bloomington Drosophila Stock Center) was used in equivalent amounts but at different heights. Food was placed in a 60 mm × 15 mm Petri dish (10060; SPL Life Sciences) to a height of 3 mm, which was lower than the food usually provided for third-instar larvae.
SABER-FISH
All of the steps were performed as described in a previous study except for a few modifications65. Three larvae were bled in 4% paraformaldehyde for 30 min. The samples were washed three times with 0.3% PBS-Tw (10× PBS + Tween-20 + H2O) for 5 min. Then, 0.3% PBS-Tw was replaced with wHyb (20× SSC + Tween-20 + formamide + H2O) and washed three times for 5 min. After the wHyb wash, the samples were replaced with Hyb1 (2× SSC + Tween-20 + formamide + 10% dextran sulfate) with probe mixture prewarmed at 43 °C and incubated for 32 h at 43 °C. After incubation, the samples were washed twice with wHyb for 30 min at 43 °C and replaced with 2× SSCT (2× SSC + Tween-20 + H2O) twice for 5 min at 43 °C, then 2× SSCT was replaced with 0.3% PBS-Tw twice for 5 min at 37 °C, and 0.3 PBS-Tw was replaced with wHyb twice for 5 min at 37 °C. The samples were replaced with wHyb to Hyb2/Flour solution (Flour Oligo Cy3 sequencer + H2O + Hyb2 solution (PBS + Tween-20 + dextran sulfate) prewarmed at 37 °C and incubated for 5 h at 37 °C and then replaced with 0.3% PBS-Tw twice for 10 min at 37 °C to wash. The samples were mounted in the Vectashield with DAPI (Vector Laboratory) and imaged using the Nikon C2 Si-plus confocal microscope (Nikon).
CAH2 probe sequences were as follows: (1) CGGGGTGTTGCGACACCTCCTC and (2) CACAAATCAAGATCGGAGCAATGACAATTG. The Flour Oligo Cy3 Imager sequence was as follows: TTATGATGATGTATGATGATGT.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
